View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5355_low_22 (Length: 248)
Name: NF5355_low_22
Description: NF5355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5355_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 6417429 - 6417660
Alignment:
| Q |
1 |
acaagcgtgacttgccctattttaacttatatcacagagcaagtactggctcnnnnnnnggcccttcacaatattaggacttttggatagtgtttattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6417429 |
acaagcgtgacttgccctattttaacttatatcacagagcaagtactggctcaaaaaaaggcccttcacaatattaggacttttggatagtgtttattta |
6417528 |
T |
 |
| Q |
101 |
aaacgtaggccagtatatgtctccaaaaataattacacgtttttcattttcccaaataaattcttagaccgttactctccacagacatttgttttatctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6417529 |
aaacgtaggccagtatatgtctccaaaaataattacacgtttttcattttcccaaataaattcttagaccgttactctccacagacatttgttttatctt |
6417628 |
T |
 |
| Q |
201 |
accccaattatgcataccacattcaatcaact |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6417629 |
accccaattatgcataccacattcaatcaact |
6417660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University