View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5355_low_23 (Length: 248)
Name: NF5355_low_23
Description: NF5355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5355_low_23 |
 | |
|
| [»] scaffold0054 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 32958714 - 32958474
Alignment:
| Q |
1 |
tttctgttggtgctaatgatgcattggaattcggtcatgacagtttttatgtgctttcctgcacttaccgttatttactctaaacaaaccaccacaacca |
100 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32958714 |
tttcttttggtgctaatgatgtattggaattcggtcatgacagtttttatgtgctttcttgcacttaccgttatttactctaaacaaaccaccacaaaca |
32958615 |
T |
|
| Q |
101 |
tctcgaccaccatccttactcgtaccatccgtattcaacaatctcattcactcgtattccaatctgcaaccgctgaacttcattctctcaaaagaaaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958614 |
tctcgaccaccatccttactcgtaccatccgtattcaacaatctcattcactcgtattccaatctgcaaccgctgaacttcattctctcaaaagaaaagg |
32958515 |
T |
|
| Q |
201 |
cgaacaacaactatataaatatgatgatattgccttctctg |
241 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32958514 |
cgaacaacaactatatatatatgatgatattgccttctctg |
32958474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 131 - 239
Target Start/End: Original strand, 38473 - 38579
Alignment:
| Q |
131 |
gtattcaacaatctcattcactcgtattccaatctgcaaccgctgaacttcattctctcaaaagaaaaggcgaacaacaactatataaatatgatgatat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| | |||| | |||||||||| |
|
|
| T |
38473 |
gtattcaacaatctcattcactcgtattccaatctgcaaccgctgaacttcattctctcaaacaaaaaggtgaacaacagc--tatagacatgatgatat |
38570 |
T |
|
| Q |
231 |
tgccttctc |
239 |
Q |
| |
|
||||||||| |
|
|
| T |
38571 |
tgccttctc |
38579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University