View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5356_high_6 (Length: 238)
Name: NF5356_high_6
Description: NF5356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5356_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 32486321 - 32486539
Alignment:
| Q |
1 |
aaaatttgattttgacaaaggttgtcttttggacaaacaatattctcaacaaacaaaatctctgttacgaatacaagccaaaataataaattatgacaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32486321 |
aaaatttgattttgacaaaggttgtcttttggacaaacaatattctcaacaaacaaaatctctgttacgaatacaagccaaaataa---attatgacaga |
32486417 |
T |
|
| Q |
101 |
ttgtattacagatcgtaccttcnnnnnnnggaaaaattattaggttccaacttgtatgtaagttattggtacgtacgttttcatatataatatggcaaca |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32486418 |
ttgtattacagatcgtaccttctttttttggaaaaattattaggttccaacttgtatgtaagttattggtacgtacgttttcatatataatatgacaaca |
32486517 |
T |
|
| Q |
201 |
aaggtgacatgcacatcaatac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32486518 |
aaggtgacatgcacatcaatac |
32486539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University