View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5356_high_7 (Length: 217)
Name: NF5356_high_7
Description: NF5356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5356_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 17000271 - 17000151
Alignment:
| Q |
1 |
ctgagatttactaggtttgatttatgattctttgaaattttctatgatttcaattcaatttgttggtggttataaccagtttaattcaaaggagtctgca |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
17000271 |
ctgagatttactagatttgatttatgattctttaaaattttctatgatttcaattcaatttgttggtggctataaccagtttaattcagaggagtctgca |
17000172 |
T |
 |
| Q |
101 |
aatgatataagcatatgcatg |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
17000171 |
aatgatataagcatatgcatg |
17000151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University