View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5356_low_6 (Length: 238)

Name: NF5356_low_6
Description: NF5356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5356_low_6
NF5356_low_6
[»] chr1 (1 HSPs)
chr1 (1-222)||(32486321-32486539)


Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 32486321 - 32486539
Alignment:
1 aaaatttgattttgacaaaggttgtcttttggacaaacaatattctcaacaaacaaaatctctgttacgaatacaagccaaaataataaattatgacaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||    
32486321 aaaatttgattttgacaaaggttgtcttttggacaaacaatattctcaacaaacaaaatctctgttacgaatacaagccaaaataa---attatgacaga 32486417  T
101 ttgtattacagatcgtaccttcnnnnnnnggaaaaattattaggttccaacttgtatgtaagttattggtacgtacgttttcatatataatatggcaaca 200  Q
    ||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
32486418 ttgtattacagatcgtaccttctttttttggaaaaattattaggttccaacttgtatgtaagttattggtacgtacgttttcatatataatatgacaaca 32486517  T
201 aaggtgacatgcacatcaatac 222  Q
    ||||||||||||||||||||||    
32486518 aaggtgacatgcacatcaatac 32486539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University