View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5357-Insertion-15 (Length: 210)
Name: NF5357-Insertion-15
Description: NF5357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5357-Insertion-15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 5 - 183
Target Start/End: Original strand, 10581919 - 10582095
Alignment:
| Q |
5 |
acaagaataacaaacaaatatgtttatactaactcaaaacaacttgttgctacatctagacctctccttgcagagagattttgtattcttcaatcgaagg |
104 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||| || |||| |
|
|
| T |
10581919 |
acaagaataacaaacaaatatgtt-atactaactcaaaacaaatttttgctacatctagacctctccttgcagagagattttgcattcttcactcaaagg |
10582017 |
T |
|
| Q |
105 |
acttgatctactaaaatatgcattcttca-tctagtcttcttaataaattctgaatattcatcaatatttatcttagaac |
183 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||| |||| ||| | | | ||||||||||||||||||||||||||||| |
|
|
| T |
10582018 |
acttgatctactaaaatatgtattcttcgctct-gtct-cttcaagcactgtgaatattcatcaatatttatcttagaac |
10582095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University