View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5357-Insertion-17 (Length: 248)
Name: NF5357-Insertion-17
Description: NF5357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5357-Insertion-17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 6 - 134
Target Start/End: Complemental strand, 51030602 - 51030474
Alignment:
| Q |
6 |
caatgtttgtgttgctggagatgctttacaccctatgacacctgatcttggtcaaggggggtgttctgctttagaggatggagtggttttagcaaggtgt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51030602 |
caatgtttgtgttgctggagatgctttacaccctatgacacctgatcttggtcaaggggggtgttctgctttagaggatggagtggttttagcaaggtgt |
51030503 |
T |
|
| Q |
106 |
ttagccgaggccttttcgaagaaaccaaa |
134 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51030502 |
ttagccgaggccttttcgaagaaaccaaa |
51030474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 6 - 134
Target Start/End: Complemental strand, 51063354 - 51063226
Alignment:
| Q |
6 |
caatgtttgtgttgctggagatgctttacaccctatgacacctgatcttggtcaaggggggtgttctgctttagaggatggagtggttttagcaaggtgt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51063354 |
caatgtttgtgttgctggagatgctttacaccctatgacacctgatcttggtcaaggggggtgttctgctttagaggatggagtggttttagcaaggtgt |
51063255 |
T |
|
| Q |
106 |
ttagccgaggccttttcgaagaaaccaaa |
134 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51063254 |
ttagccgaggccttttcgaagaaaccaaa |
51063226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 7 - 119
Target Start/End: Complemental strand, 51068922 - 51068810
Alignment:
| Q |
7 |
aatgtttgtgttgctggagatgctttacaccctatgacacctgatcttggtcaaggggggtgttctgctttagaggatggagtggttttagcaaggtgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51068922 |
aatgtttgtgttgctggagatgctttacaccctatgacacctgatcttggtcaaggggggtgttctgctttagaggatggggtggttttagcaaggtgtc |
51068823 |
T |
|
| Q |
107 |
tagccgaggcctt |
119 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
51068822 |
tagctgaggcctt |
51068810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 4 - 134
Target Start/End: Complemental strand, 51034882 - 51034752
Alignment:
| Q |
4 |
aacaatgtttgtgttgctggagatgctttacaccctatgacacctgatcttggtcaaggggggtgttctgctttagaggatggagtggttttagcaaggt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||| ||||| |||||| ||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
51034882 |
aacaatgtttgtgttgctggagatgctttgcacccaatggcaccttatcttgcccaaggggggtgttgtgctttagaggatggggtggttttagcaaggt |
51034783 |
T |
|
| Q |
104 |
gtttagccgaggccttttcgaagaaaccaaa |
134 |
Q |
| |
|
| |||| |||| ||||| ||||||||||| |
|
|
| T |
51034782 |
gcttaggtgaggtattttccaagaaaccaaa |
51034752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 7 - 110
Target Start/End: Original strand, 40618059 - 40618162
Alignment:
| Q |
7 |
aatgtttgtgttgctggagatgctttacaccctatgacacctgatcttggtcaaggggggtgttctgctttagaggatggagtggttttagcaaggtgtt |
106 |
Q |
| |
|
||||||||||||| ||| |||||||||||| ||||| |||||||||||| ||||||||||||||||||||||| ||||| ||||| ||||||||||| | |
|
|
| T |
40618059 |
aatgtttgtgttgttggtgatgctttacactctatggcacctgatcttgcccaaggggggtgttctgctttagaagatggggtggtattagcaaggtgct |
40618158 |
T |
|
| Q |
107 |
tagc |
110 |
Q |
| |
|
|||| |
|
|
| T |
40618159 |
tagc |
40618162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 51030412 - 51030366
Alignment:
| Q |
202 |
tggagatgcattgatctcattactgcatcttatattgtgggttatat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51030412 |
tggagatgcattgatctcattactgcatcttatattgtgggttatat |
51030366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University