View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5357-Insertion-6 (Length: 497)
Name: NF5357-Insertion-6
Description: NF5357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5357-Insertion-6 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 316; Significance: 1e-178; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 178 - 497
Target Start/End: Original strand, 6995478 - 6995797
Alignment:
| Q |
178 |
gaaccgggtttaatttagataacggttcaagggttcagaccttatcttgttcagcaagtgcaagcttatcggcggcttcagaaagcgcagcgtggagagg |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6995478 |
gaaccgggtttaatttagataacggttcaagggttcagaccttatcttgttcagcaagtgcaagcttatcggcggcttcagaaagagcagcgtggagagg |
6995577 |
T |
 |
| Q |
278 |
ctctccctgagcttccagctccgcgatgagctcgtctttcttgacgagctcatcacgtagagcagaaacttctgattggagcgtgttgacacgtgttgaa |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6995578 |
ctctccctgagcttccagctccgcgatgagctcgtctttcttgacgagctcatcacgtagagcagaaacttctgattggagcgtgttgacacgtgttgaa |
6995677 |
T |
 |
| Q |
378 |
agggcaatggaggtgattttgcgagccacatcgagttgctcgaaaggatcggatggtagaacttgcagcaactcctcaggaatatcgaggttcgaaccac |
477 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6995678 |
agggcaatggaggtgattttgcgagccacatcgagttgctcgaaaggatcggatggtagaacttgcagcaactcctcaggaatatcgaggttcgaaccac |
6995777 |
T |
 |
| Q |
478 |
tcaattccgccaccaacatg |
497 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6995778 |
tcaattccgccaccaacatg |
6995797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 6995309 - 6995399
Alignment:
| Q |
8 |
aaaaccaaatagtttgcaccttggagacatctctactgagcttcctcactgtactagaaagtgaagcattctccttcaacaacttctccta |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6995309 |
aaaaccaaatagtttgcaccttggagacatctctactgagcttcctcactgtactagaaagtgaagcattctccttcaacaacttctccta |
6995399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 444
Target Start/End: Complemental strand, 49085276 - 49085195
Alignment:
| Q |
363 |
ttgacacgtgttgaaagggcaatggaggtgattttgcgagccacatcgagttgctcgaaaggatcggatggtagaacttgca |
444 |
Q |
| |
|
||||||||||| || || |||||||| ||||| ||||| || ||||||||||| || || ||||| || ||||| ||||||| |
|
|
| T |
49085276 |
ttgacacgtgtcgatagagcaatggatgtgatcttgcgcgctacatcgagttgttcaaatggatctgacggtagtacttgca |
49085195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University