View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5357_low_10 (Length: 267)
Name: NF5357_low_10
Description: NF5357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5357_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 35702654 - 35702767
Alignment:
| Q |
1 |
attatgaaccctaatcaaattacttgtagattatgctttattgtaatttgaattttgtggatttaattatgggtttgatcttgaacaactcatgaaagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35702654 |
attatgaaccctaatcaaattacttgtagattatgctttattgtaatttgagttttgtggatttcattatgggtttgatcttgaacaactcatgaaagat |
35702753 |
T |
|
| Q |
101 |
aaagtcccaaaatt |
114 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
35702754 |
aaagttccaaaatt |
35702767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 184 - 257
Target Start/End: Original strand, 35702824 - 35702897
Alignment:
| Q |
184 |
gtcttagcagtaataatctgttttgaggttattacactannnnnnnatgttattttttatgttaacagtctgtg |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||| |
|
|
| T |
35702824 |
gtcttagcagtaataatctgttttgaggttattacgctatttttttatgttatttttcatgttaacagtctgtg |
35702897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University