View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5358_high_4 (Length: 332)

Name: NF5358_high_4
Description: NF5358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5358_high_4
NF5358_high_4
[»] chr3 (1 HSPs)
chr3 (291-332)||(34899934-34899975)


Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 291 - 332
Target Start/End: Original strand, 34899934 - 34899975
Alignment:
291 catataggtaaagtttggtagtttcaactttcaagttgagat 332  Q
    ||||||||||||||||||||||||||||||||||||||||||    
34899934 catataggtaaagtttggtagtttcaactttcaagttgagat 34899975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University