View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5358_high_7 (Length: 320)
Name: NF5358_high_7
Description: NF5358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5358_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 43 - 299
Target Start/End: Original strand, 53367043 - 53367299
Alignment:
| Q |
43 |
gtgtaagttgatttccctgctcatcttcatcagcaattacaattcttaaagcagcataattaggtggaggactccatgtcttccttgtactagttgttgt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53367043 |
gtgtaagttgatttccctgctcatcttcatcagcaattacaattcttaaagcagcataattaggtggaggactccatgtcttccttgtactagttgttgt |
53367142 |
T |
 |
| Q |
143 |
atctgtttgataaactacatcatcactatttctagaatcggcatctgcttttatttctattgcgtaatctttgtctttgttaacagcaacagcatccaca |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
53367143 |
atctgtttgataaactacatcatcactatttctagaatcggcatctgcttttatttctattgcgtaatctctgtctttgttaacggcaacagcatccaca |
53367242 |
T |
 |
| Q |
243 |
gaagccttttcattagtagaaccatcccagcggtaaaaagcatttacatttacattt |
299 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53367243 |
gaagccttttcattagtagaaccatcccaacggtaaaaagcatttacatttacattt |
53367299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University