View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5359-Insertion-4 (Length: 275)
Name: NF5359-Insertion-4
Description: NF5359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5359-Insertion-4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 8 - 275
Target Start/End: Complemental strand, 41861082 - 41860815
Alignment:
| Q |
8 |
ttttaaactactacaatcacttaagacttgagcatggtcctaacatttctggttttcaatttttgcttgaaccagataaccaattgcagttggattccca |
107 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41861082 |
ttttaaactactacaatcacttgagacttgagcatggtcctaacatttctggttttcaatttttgcttgaaccagataaccaattgcagttggattccca |
41860983 |
T |
|
| Q |
108 |
actatgcttaattggtaaaaagaaacttcctggcagagggataactggctttcaggtattttgcttttgcttcttgtgttaagtaacatttgtgattatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41860982 |
actatgcttaattggtaaaaagaaacttcctggcagagggataactggctttcaggtattttgcttttgcttcttgtgttaagtaacatttgtgattatc |
41860883 |
T |
|
| Q |
208 |
ttttctctgacaattttttggtgattaactgcgaatttgttatttatttcagtttcttcctcaagatt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41860882 |
ttttctctgacaattttttggtgattaactgcgaatttgttatttatttcagtttcttcctcaagatt |
41860815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 67 - 167
Target Start/End: Original strand, 531864 - 531964
Alignment:
| Q |
67 |
tttttgcttgaaccagataaccaattgcagttggattcccaactatgcttaattggtaaaaagaaacttcctggcagagggataactggctttcaggtat |
166 |
Q |
| |
|
|||||| ||||| ||||||| ||||| | | || | || |||||||||||| |||||||||||||| | |||| ||||| ||||| ||||||||||||| |
|
|
| T |
531864 |
tttttggttgaatcagataatcaattacggatgcaatcacaactatgcttacttggtaaaaagaaatcttctggaagaggaataaccggctttcaggtat |
531963 |
T |
|
| Q |
167 |
t |
167 |
Q |
| |
|
| |
|
|
| T |
531964 |
t |
531964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University