View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5359-Insertion-8 (Length: 54)
Name: NF5359-Insertion-8
Description: NF5359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5359-Insertion-8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 42; Significance: 9e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 9e-16
Query Start/End: Original strand, 5 - 54
Target Start/End: Original strand, 39401402 - 39401451
Alignment:
| Q |
5 |
acaacataagtacatgtaattacattgttattatgtgtttcgtgttggtg |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
39401402 |
acaacataagtacatgtaattacattgttagtatatgtttcgtgttggtg |
39401451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University