View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5359_high_12 (Length: 340)
Name: NF5359_high_12
Description: NF5359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5359_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 4e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 78 - 293
Target Start/End: Original strand, 2431034 - 2431249
Alignment:
| Q |
78 |
atggacaggttaatctgtgacctatacctttagaggnnnnnnnnggccatgtttgctgtagtacaatacaagtatatttgtttaactacacatgcattaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2431034 |
atggacaggttaatctgtgacctatacctttagaggaaaaaaaaggccatgtttgctgtagtacaatacaagtatatttgtttaactacacatgcattaa |
2431133 |
T |
 |
| Q |
178 |
ttattttattttatatgtaggtctagactttcttgttgacagccttcttgatgcttcgaacaaagaacatgtggctgtagctttatgcaaattaacaaat |
277 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2431134 |
ttattttattatatatgtaggtctagactttcttgtttacagccttcttgatgcttcgaacaaagaacatgtggctgtagctttatgcaaattaacaaat |
2431233 |
T |
 |
| Q |
278 |
aaagttttgcttgttg |
293 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
2431234 |
aaatttttgcttgttg |
2431249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 10 - 38
Target Start/End: Original strand, 2430964 - 2430992
Alignment:
| Q |
10 |
gcagagaaatagaccttggggtgaccaaa |
38 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2430964 |
gcagagaaatagaccttggggtgaccaaa |
2430992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University