View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5359_low_11 (Length: 348)
Name: NF5359_low_11
Description: NF5359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5359_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 15 - 330
Target Start/End: Complemental strand, 42155584 - 42155269
Alignment:
| Q |
15 |
tcatcactgaaatttatcaaatgggaaattgttctttcaagggtaccactggtgaatgccatcactctatcagaattctatgtgatagtggttcaatttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42155584 |
tcatcactgaaatttatcaaatgggaaattgttctttcaagggtaccactggtgaatgccatcactctatcagaattctatgtgatagtggttcaatttt |
42155485 |
T |
|
| Q |
115 |
acaattcaaaggtcccaaaacagttgcacaagtcctcgaaaatcatccgggttatggtgtttttcgccaaggccatgtggcaccattattagaccaagag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42155484 |
acaattcaaaggtcccaaaacagttgcacaagtcctcgaaaatcatccgggttatggtgtttttcgccaaggccatgtggcaccattatcagaccaagag |
42155385 |
T |
|
| Q |
215 |
agcttaagctatggtcttctctattatcttcttcccttgaaggaggtacaacccgatcaaaaaactagctccagtgacggagtttctgaacaagagctgg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42155384 |
agcttaagctatggtcttctctattatcttcttcccttgaaggaggtacaacccgatcaaaaaactagctccagtgacggagtttctgaacaagagctgg |
42155285 |
T |
|
| Q |
315 |
ttcaaagatcagatgt |
330 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42155284 |
ttcaaagatcagatgt |
42155269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University