View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5359_low_17 (Length: 243)
Name: NF5359_low_17
Description: NF5359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5359_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 10 - 227
Target Start/End: Complemental strand, 54689631 - 54689414
Alignment:
| Q |
10 |
gcagagagcttttgaggtttgtttctacagcaacttccattttctcttgtctgaaaaagaaagatgactatgagatcagaaaacatgtcagggttatagt |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54689631 |
gcagagagcttttggggtttgtttctacagcaacttccattttctcttgtctgaaaaagaaagatgactatgagatcagaaaacatgtcagggttatagt |
54689532 |
T |
|
| Q |
110 |
agttgttatcttctcaatataaagcaaataattacaggagacaagaatcgtattttatattttaaaattcaactggtagtgctaaggggcaatataatta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54689531 |
agttgttatcttctcaatataaagcaaataattacaggagacaagaatcgtattttatattttaaaattcaactggtagtgctaaggggcaatataatta |
54689432 |
T |
|
| Q |
210 |
gaggggcatgcatgtgat |
227 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
54689431 |
gaggggcgtgcatgtgat |
54689414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University