View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5359_low_23 (Length: 204)
Name: NF5359_low_23
Description: NF5359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5359_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 54 - 180
Target Start/End: Original strand, 55048156 - 55048282
Alignment:
| Q |
54 |
gttacagaaaacaatgatttcaatagagttcctggatacagctacagaatcatgacataaactgactctatgtggagttatattgctgcatgttcatgtt |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55048156 |
gttacagaaaacaatgatttcaatagagttcctggatacagctacaggatcatgacataaactgactctatgtggagttatattgctgcatgttcatgtt |
55048255 |
T |
|
| Q |
154 |
atttttgtttattcatttgggtaatta |
180 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
55048256 |
atttttgtttattcatttgggtaatta |
55048282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 144
Target Start/End: Original strand, 55047068 - 55047209
Alignment:
| Q |
12 |
agcagagaggtccaaatgaatttctacnnnnnnncatgttctgttacagaaaacaatgatttcaatagagttcctggatacagctacagaatc------- |
104 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||| || ||||||| |||| ||||||||||||||||||| | ||| ||||| ||| |
|
|
| T |
55047068 |
agcaaagaggtccaaatgaatttctaccaaaaa-catgttcagtaacagaaagcaattatttcaatagagttcctggttgcaggtacaggatccttaagg |
55047166 |
T |
|
| Q |
105 |
---atgacataaactgactctatgtggagttatattgctgcat |
144 |
Q |
| |
|
||||||| |||||| ||||||||||||||| ||||||||| |
|
|
| T |
55047167 |
atcatgacattaactgaatctatgtggagttatgttgctgcat |
55047209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University