View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5360-Insertion-8 (Length: 192)
Name: NF5360-Insertion-8
Description: NF5360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5360-Insertion-8 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 3e-41; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 3e-41
Query Start/End: Original strand, 102 - 192
Target Start/End: Complemental strand, 54957914 - 54957824
Alignment:
| Q |
102 |
tacccttagtttattggtggggttgtggtcaagatttatggtttgtgggagtggttccatgacatgttcatttcctggttgagtttgctgg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54957914 |
tacccttagtttattggtggggttgtggtcaggatttatggtttgtgggagtggttccatgacatgttcttttcctggttgagtttgctgg |
54957824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000001
Query Start/End: Original strand, 39 - 88
Target Start/End: Complemental strand, 54958006 - 54957957
Alignment:
| Q |
39 |
aagtccwccaaatcgtgagtcttttttaaattttgaaaaatacatgattt |
88 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
54958006 |
aagtccaccaaatcttgagtcttttttaaattttgtaaaatacatgattt |
54957957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University