View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5360_high_2 (Length: 431)
Name: NF5360_high_2
Description: NF5360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5360_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 18 - 420
Target Start/End: Original strand, 2361039 - 2361429
Alignment:
| Q |
18 |
tgaagtaggagaaaataaactcttattattattgttttgagattgtgattgagattgagattcttcaccggagtttgccggtaacggtaatgacggaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2361039 |
tgaagtaggagaaaataaactcttattattattgttttga------------gattgagattcttcaccggagtttgccggtaacggtaatgacgaaaga |
2361126 |
T |
 |
| Q |
118 |
ggaatttcattttccggtggtggtgatgataactgacacgtggcagctgcacttacaggtggagttatgaaattagttagcgcgtctggtccacgcaact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2361127 |
ggaatttcattttccggtggtggtgatgataactgacacgtggcagctgcacttacaggtggagttatgaaattagttagcgcgtctggtccacgcaact |
2361226 |
T |
 |
| Q |
218 |
taatagccgcgttgtcgtacacaatagcagcttcttcagccgtttgaaatgtaccaagccacacacgcactccacgcgccgggtctcttatctccgccgc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2361227 |
taatagccgcgttgtcgtacacaatagcagcttcttcagccgtttgaaatgtaccaagccacacacgcactccacgcgccgggtctcttatctccgccgc |
2361326 |
T |
 |
| Q |
318 |
ccattttccccatggtctctgcctcactccacggtatttcttcgccggaatactcaccggagctcttgtttttcttcctccggtggttctgtttctgttt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2361327 |
ccattttccccatggtctctgcctcactccacggtatttcttcgccggaatactaaccggagctcttgtttttcttcctccggtggttctgtttctgttt |
2361426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 298 - 360
Target Start/End: Complemental strand, 41747998 - 41747936
Alignment:
| Q |
298 |
gggtctcttatctccgccgcccattttccccatggtctctgcctcactccacggtatttcttc |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||| |
|
|
| T |
41747998 |
gggtctcttatctccgccgcccattttccccaaggtctctgtctcactccacgatatttcttc |
41747936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 347
Target Start/End: Complemental strand, 33721025 - 33720985
Alignment:
| Q |
307 |
atctccgccgcccattttccccatggtctctgcctcactcc |
347 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
33721025 |
atctcagcagcccattttccccatggtctctgcctcactcc |
33720985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 307 - 360
Target Start/End: Complemental strand, 33735679 - 33735626
Alignment:
| Q |
307 |
atctccgccgcccattttccccatggtctctgcctcactccacggtatttcttc |
360 |
Q |
| |
|
||||| || ||||||||||||||||| |||||||||||||| | ||| |||||| |
|
|
| T |
33735679 |
atctcagcagcccattttccccatggcctctgcctcactcctctgtacttcttc |
33735626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 307 - 347
Target Start/End: Complemental strand, 33719006 - 33718966
Alignment:
| Q |
307 |
atctccgccgcccattttccccatggtctctgcctcactcc |
347 |
Q |
| |
|
||||| || ||||||||||||||||||||||| |||||||| |
|
|
| T |
33719006 |
atctcagcagcccattttccccatggtctctgtctcactcc |
33718966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 43490153 - 43490208
Alignment:
| Q |
301 |
tctcttatctccgccgcccattttccccatggtctctgcctcactccacggtattt |
356 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||| || ||||| | |||||| |
|
|
| T |
43490153 |
tctcttatctctgctgcccattttccccatggtctctgtcttactcctctgtattt |
43490208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 199 - 272
Target Start/End: Complemental strand, 41197611 - 41197538
Alignment:
| Q |
199 |
gcgtctggtccacgcaacttaatagccgcgttgtcgtacacaatagcagcttcttcagccgtttgaaatgtacc |
272 |
Q |
| |
|
|||||||||||||| | ||||||||| || ||||| || || |||||||||||||| || |||| ||| ||||| |
|
|
| T |
41197611 |
gcgtctggtccacgaagcttaatagcggcattgtcataaaccatagcagcttcttctgcagtttcaaaagtacc |
41197538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University