View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5360_high_5 (Length: 271)
Name: NF5360_high_5
Description: NF5360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5360_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 17 - 254
Target Start/End: Complemental strand, 3710421 - 3710183
Alignment:
| Q |
17 |
caaaggcgaaaagcacataaataatgaagaaaacaaggaaaatagtcattgtccaatgcaccccatgcatgcaaccacgatccccgcacatattgaaaga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||| |||| |||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
3710421 |
caaaggcgaaaagcacataaataatgaaggaaatgaggaaaatagccattctccaatgcaccccatgaatgcaatcacgatccccgcacatattgaaaga |
3710322 |
T |
 |
| Q |
117 |
cgnnnnnnntgagttttaaaatggaccacgtgacataatctagatatattatttgctaaggtaattttcctagagatagggaattaattagtatg--ata |
214 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3710321 |
cgaaaaaa-tgagttttaaaatggaccacgtgacataatctagatatattatttgctaaggtaattttcctagagatagggaattaattagtatgacata |
3710223 |
T |
 |
| Q |
215 |
gtttaacattcttgcaagcttttgatgacatgagtttttt |
254 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3710222 |
gtttaacattcttccaagcttttgatgacatgagtttttt |
3710183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 154 - 182
Target Start/End: Complemental strand, 9848623 - 9848595
Alignment:
| Q |
154 |
atctagatatattatttgctaaggtaatt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9848623 |
atctagatatattatttgctaaggtaatt |
9848595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University