View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5360_low_4 (Length: 290)
Name: NF5360_low_4
Description: NF5360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5360_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 71 - 274
Target Start/End: Original strand, 32377924 - 32378124
Alignment:
| Q |
71 |
cgtttctttatgtggacacnnnnnnntcatgggaaaaaatgttggcgggttatttggtaaagaagtggtattgggatcaatgcaatttttctatggtttc |
170 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32377924 |
cgtttctttatgtggacacaaaaaaatcatgggaaaaaatgttggcgggttatttggtaaagaagtggtattgggatcaatgcaatttttctatggtttc |
32378023 |
T |
 |
| Q |
171 |
aaatcttcaaaggaataactcaataaaaaatatatatatttaaaggaagttttgttaggtgtgagtccgtgacaatagtgtcaaaaccaaatttatttat |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32378024 |
aaatcttcaaaggaataactcaataaaaaa---aaatatttaaaggaagttttgttaggtgtgagtccgtgacaatagtgtcaaaaccaaattgatttat |
32378120 |
T |
 |
| Q |
271 |
aatt |
274 |
Q |
| |
|
|||| |
|
|
| T |
32378121 |
aatt |
32378124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University