View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5361_high_4 (Length: 379)
Name: NF5361_high_4
Description: NF5361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5361_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 35 - 264
Target Start/End: Complemental strand, 34899975 - 34899746
Alignment:
| Q |
35 |
atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcttctctcgctatttgatgtcaacaaaagctaa |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899975 |
atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcttctctcgctatttgatgtcaacaaaagctaa |
34899876 |
T |
|
| Q |
135 |
attgtgtcttcccctgcgtgtatgcaaccttatagtctcaaaattttccttccattctcaccaaacatgaaaggtatgtatcttccaactacaaaatttt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899875 |
attgtgtcttcccctgcgtgtatgcaaccttatagtctcaaaattttccttccattctcaccaaacatgaaaggtatgtatcttccaactacaaaatttt |
34899776 |
T |
|
| Q |
235 |
atgtgaatttgtgcagatgatatcactgac |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34899775 |
atgtgaatttgtgcagatgatatcactgac |
34899746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 313 - 353
Target Start/End: Complemental strand, 44885480 - 44885440
Alignment:
| Q |
313 |
tacagtcagttgtaatatttaccttgtggaagttgaggttg |
353 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44885480 |
tacagccagttgtaatatttaccttgtggaagttgaggttg |
44885440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University