View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5363_high_4 (Length: 330)
Name: NF5363_high_4
Description: NF5363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5363_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 16 - 325
Target Start/End: Complemental strand, 16919994 - 16919686
Alignment:
| Q |
16 |
aaagtttccatccctatgcaggagatagaagatgatctggtttggacacatacaacaaatggtagtttatcttttaaggatgcttataagtttaaagaca |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |||||||||||| |
|
|
| T |
16919994 |
aaagttaccatccctatgcaggagatagaagatgatctggtttggacacatacaacaaatggaagcttatcttttaaggatgcttatgagtttaaagaca |
16919895 |
T |
|
| Q |
116 |
ccccttcccagtctattcaatgggccaaaactatttggtctccaaacattccccctatcaaaatctctgcttgcatggagattaatgaacgataaaatcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16919894 |
ccccttcccagtctattcaatgggccaaaactatctggtctccaaacattccccc-atcaaaatctctgcttgcatggagattaatgaacgataaaatcc |
16919796 |
T |
|
| Q |
216 |
cagttgatgagaacctaaaagatagaggatgccatttgccttcagtttgcagtctttgcatggtttcggaggaaacgatttttcaccttttctttgattg |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
16919795 |
cagttgatgagaacctaaaagatagaggatgtcatttgccttcagtttgcagtctttgcatggtttctgaggaaacggcttttcacctattctttgattg |
16919696 |
T |
|
| Q |
316 |
tccctatgct |
325 |
Q |
| |
|
||| |||||| |
|
|
| T |
16919695 |
tccttatgct |
16919686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University