View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5363_low_12 (Length: 254)
Name: NF5363_low_12
Description: NF5363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5363_low_12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 45548701 - 45548447
Alignment:
| Q |
1 |
ataagggatacagaaaagcatatccttagtatacttctggatgagatcgccaaagaatattgcacattcaaggagcgctgattgaatatgacaaccatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548701 |
ataagggatacagaaaagcatatccttagtatacttctggatgagatcgccaaagaatattgcacattcaaggagcgctgattgaatatgacaaccatac |
45548602 |
T |
|
| Q |
101 |
tatggaagttttttatgt-atttgcaatacaattttgttggttgtaagtttgtaactggtgaggagttctgaacagcaagttttcattagaaagaagagt |
199 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548601 |
tatgaaagttttttatgttatttgcaatacaattttgttggttgtaagtttgtaactggtgaggagttctgaacagcaagttttcattagaaagaagagt |
45548502 |
T |
|
| Q |
200 |
ttcctcctttattaagttactataaaactttaacatggagtaaaatcttttaaat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548501 |
ttcctcctttattaagttactataaaactttaacatggagtaaaatcttttaaat |
45548447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University