View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5365_low_3 (Length: 245)
Name: NF5365_low_3
Description: NF5365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5365_low_3 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 121 - 245
Target Start/End: Complemental strand, 10983075 - 10982951
Alignment:
| Q |
121 |
cataaagaaatagtatcgctgagcacttttaaaataatttgtgtagaaaaggataattgtgcaaatatttatgaattaaaccacctatttattacaaaaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10983075 |
cataaagaaatagtatcgctgagcacttttaaaataatttgtatggaaaaggataattgtgcaaatatttatgaattaaaccacctatttattacaaaaa |
10982976 |
T |
 |
| Q |
221 |
caaataaattaaaggagcccaattt |
245 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
10982975 |
caaataaattaaaggagcccaattt |
10982951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University