View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5366_high_2 (Length: 343)
Name: NF5366_high_2
Description: NF5366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5366_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 112 - 328
Target Start/End: Complemental strand, 41747841 - 41747625
Alignment:
| Q |
112 |
cgatcacaatgtcgtggatgaaagttttgattctgcagcgaggggtaaaattggaatgtgttggattttcttcttcgtcagaagaagaatccgtggcgtc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41747841 |
cgatcacaatgtcgtggatgaaagttttgattctgcggcgaggggtaatattggaatgtattggattttcttcttcgtcagaagaagaatccgtggcgtc |
41747742 |
T |
 |
| Q |
212 |
agggtcggtgtaacgtatttgtatagtttttggcatgatgttgttgatttgtgtgaagtgatgagtgtgtttgatgatgttaggaataggaggaggtgta |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
41747741 |
agggtcggtgtaacgtatttgtatagtttttggcatgatgttgttgatttgtgtgaagtgatgagtgtgtttgatgatgttgggaatgggaggaggtgta |
41747642 |
T |
 |
| Q |
312 |
gaaggttgtttaggcat |
328 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
41747641 |
gaaggttgtttgggcat |
41747625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 41747952 - 41747900
Alignment:
| Q |
1 |
ctccacgatatttcttcccggtgcaaatcaccggccgccgttgagtcgccgga |
53 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41747952 |
ctccacgatatttcttcccggtgtaaatcaccggccgccgttgagtcgccgga |
41747900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University