View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5366_low_5 (Length: 276)
Name: NF5366_low_5
Description: NF5366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5366_low_5 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 17 - 276
Target Start/End: Complemental strand, 41748235 - 41747976
Alignment:
| Q |
17 |
tcttttactgttacggattcacctccttctgaggaagaagtacaacattgaagtactgacgtggcagaaacaacgcattcatcgctgctggagtttataa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41748235 |
tcttttactgttacggattcacctccttctgaggaagaagtacaacattgaagtactgacgtggcagaaacaacgcattcatcgctgctggagtttataa |
41748136 |
T |
 |
| Q |
117 |
caaccttctttgtcgtgggttgaatgaaattcgtaagcgcgtctgcaccacgtatttcaatggcggctttatcatactccatagcagcttcttcagcagt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41748135 |
caaccttctttgtcgtgggttgaatgaaattcgtaagcgcgtctgcaccacgtatttcaatggcggctttatcatactccatagcagcttcttcagcagt |
41748036 |
T |
 |
| Q |
217 |
gttgtaagttcccaaccaccgtcgaaatttgattttggggtctcttatctccgccgccca |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41748035 |
gttgtaagttcccaaccaccgtcgaaatttgagtttggggtctcttatctccgccgccca |
41747976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 234
Target Start/End: Complemental strand, 8585005 - 8584973
Alignment:
| Q |
202 |
agcttcttcagcagtgttgtaagttcccaacca |
234 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
8585005 |
agcttcttcagcactgttgtaagttcccaacca |
8584973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University