View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5366_low_6 (Length: 271)
Name: NF5366_low_6
Description: NF5366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5366_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 65 - 191
Target Start/End: Complemental strand, 48277895 - 48277769
Alignment:
| Q |
65 |
ttttcttttctttggaaatttgattgaaggtgaaggatgattgatggattataaatcaaagatatttatttatacctttattgcaagaagacaacttgaa |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48277895 |
ttttcttttctttggaaatttgattgaaggtgaaggatgattgatggattataaatcaaagatatttatttatacctttattgcaagaagacaacttgaa |
48277796 |
T |
 |
| Q |
165 |
ttgccatctaacacgataaggaattac |
191 |
Q |
| |
|
||||| ||||||||||||||||||||| |
|
|
| T |
48277795 |
ttgccctctaacacgataaggaattac |
48277769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 192 - 271
Target Start/End: Complemental strand, 48277742 - 48277663
Alignment:
| Q |
192 |
aggtaacgaataaacgactttgaacgcgtcgtcaataccacttgcatacttttcgaatacatccatacctttttgctatc |
271 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48277742 |
aggtaacgaataaacgactttgtacgcgtcgtcaataccacttgcatacttttcgaatacatccataactttttgctatc |
48277663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 13 - 73
Target Start/End: Complemental strand, 48278290 - 48278230
Alignment:
| Q |
13 |
ttctatctatataatttgaaaagaaaatctcaannnnnnnaattagttgtagttttctttt |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48278290 |
ttctatctatataatttgaaaagaaaatctcaatttttttaattagttgtagttttctttt |
48278230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University