View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5367_high_34 (Length: 312)
Name: NF5367_high_34
Description: NF5367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5367_high_34 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 28 - 312
Target Start/End: Original strand, 25703204 - 25703488
Alignment:
| Q |
28 |
ttttccatcttgatgaccggtgaagatgtttccttcggatataacaatggttttgaccaaaccactacttgatttaagaccggtataatctttaagttct |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25703204 |
ttttccatcttgatgaccggtgaagatgtttccttcggatataacaatggatttgaccaaaccactacttgatttaaaaccggtataatctttaagttct |
25703303 |
T |
 |
| Q |
128 |
ttccacacccttatgtttttgctatcggtaccggtgtataacatgtcaccggaaacggctaaggagtagatgtgaccttcttcgcgagctagtgacccga |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25703304 |
ttccacacccttatgtttttgctatcggtaccggtgtataacatgtcaccggaaacggctaaggagtagatgtgaccttcttcgcgagctagtgacccga |
25703403 |
T |
 |
| Q |
228 |
tgaggccattttccgggaaatagctgtcgttgtaattgttgtcgtggcggtggctgtggtggtattggaagaggttgattgcttc |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25703404 |
tgaggccattttccgggaaatagctgtcgttgtaattgttgtcgtggcggtggctgtggtggtattggaagaggttgattgcttc |
25703488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University