View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5368_high_36 (Length: 216)

Name: NF5368_high_36
Description: NF5368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5368_high_36
NF5368_high_36
[»] chr2 (1 HSPs)
chr2 (20-200)||(45625587-45625767)


Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 20 - 200
Target Start/End: Original strand, 45625587 - 45625767
Alignment:
20 atctttctatgaatggattggcaggagagtatgaaactaagagtagaggaaagagacatactagtgatgccagagcattgggagaaggcatataccgcat 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45625587 atctttctatgaatggattggcaggagagtatgaaactaagagtagaggaaagagacatactagtgatgccagagcattgggagaaggcatataccgcat 45625686  T
120 tttaaggcacaaagcagagagtgggaaaagaagccacacccatttaatctacaagttagaatttccaggtgaagatgagaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45625687 tttaaggcacaaagcagagagtgggaaaagaagccacacccatttaatctacaagttagaatttccaggtgaagatgagaa 45625767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University