View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5368_low_10 (Length: 337)
Name: NF5368_low_10
Description: NF5368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5368_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 17595499 - 17595752
Alignment:
| Q |
18 |
agaagtaatacctattttctttatttgtctcttagtcaaaatatgttgttggtttgtgttatcatgatcttgttgatttcttccaagattgtgagcactg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17595499 |
agaagtaatacctattttctttatttgtctcttagtcaaaatatgttgttggtttgtgttatcatgatcttgttgatttcttccaagattgtgagcactg |
17595598 |
T |
|
| Q |
118 |
tagttgctacaagtatatatggaatgtctcttagagatagtatggctcttggagtgctcatgaatactaaaggtgtcttgtcattgattatactaaacat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |||||||||| |
|
|
| T |
17595599 |
tagttgctacaagtatatatggaatgtctcttagagatagtatggctcttggagtgctcatgaatacaaaaggtgtcttatcattgattgtactaaacat |
17595698 |
T |
|
| Q |
218 |
tggatgggatagaaaggtattattcatttacttgtatatacacattattgttac |
271 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
17595699 |
tggatgggatagaaaggtattattcatttctttgtatatatacattattgttac |
17595752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 289 - 327
Target Start/End: Original strand, 17595740 - 17595778
Alignment:
| Q |
289 |
acattattgttacttgataaaaccttttgttaccctttg |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17595740 |
acattattgttacttgataaaaccttttgttaccctttg |
17595778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University