View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5368_low_20 (Length: 253)
Name: NF5368_low_20
Description: NF5368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5368_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 26806446 - 26806679
Alignment:
| Q |
1 |
ttttccaataaatacttttaaaaaattccaaattggtccttatatannnnnnncaaaattaacaaacctagattatcaaattttgtaaattagtccctat |
100 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26806446 |
ttttccaataaatacttctaaaaaatcccaaattggtccttatatatttttttcaaaattaacaaacctagattatcaaattttgtaaattagtccctat |
26806545 |
T |
|
| Q |
101 |
tttgagaatggagaattttattactctattcaaatgnnnnnnnnnnnnnnnntgaatggaattgaagctttcgaattgcttaaaattataatttctctta |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26806546 |
tttgagaatcgagaattttattactctattcaaatg-aaaaaaaattaaaaatgaat-gaattgaagctttcgaattgcttaaaattataatttctctta |
26806643 |
T |
|
| Q |
201 |
atttcccattatcctatccaacaaactctaaaaatg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
26806644 |
atttcccattatcctatccaacaaactctaaaaatg |
26806679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University