View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5368_low_32 (Length: 243)
Name: NF5368_low_32
Description: NF5368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5368_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 3 - 227
Target Start/End: Complemental strand, 26806438 - 26806219
Alignment:
| Q |
3 |
aatttataaaatacagggaccatctccaaaatttatactaacattcaattatattagaacttaata-ttttttcgtcaannnnnnnctttctaatcgtgt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
26806438 |
aatttataaaatacagggaccatctccaaaatttatactaacattcaattatactagaacttattatttttttcgtcaatttttttctttctaatcgtgt |
26806339 |
T |
 |
| Q |
102 |
tattatcggacattaaatattaccctctcttagtcataatttaatttgaaccttgatgcgtcgtattgttggatctactccttctactacactcaatcct |
201 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26806338 |
tattatcggacattaaatattaccc-ctcttagtca-----gaatttgaaccttgatgtgtcatattgttggatctactccttctactacactcaatcct |
26806245 |
T |
 |
| Q |
202 |
cattggtcaccgaacctcacctttat |
227 |
Q |
| |
|
||||||||||| |||||||| ||||| |
|
|
| T |
26806244 |
cattggtcacccaacctcacttttat |
26806219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University