View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5368_low_35 (Length: 239)
Name: NF5368_low_35
Description: NF5368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5368_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 82 - 232
Target Start/End: Original strand, 5215975 - 5216126
Alignment:
| Q |
82 |
gtcatagaagatcaaaaatatgctgacttagcaatattgaagactgcatatgaactgaatatcaaagatatttttgttcatatatagttc---taatgaa |
178 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||| || || |||||||||| |||||||||||||||||| ||| ||||||||| ||||| | |
|
|
| T |
5215975 |
gtcatagaagatcaaaagtatgcagacttagcaatattggaggcttcatatgaacttaatatcaaagatatttttattc--atatagttctattaatgta |
5216072 |
T |
|
| Q |
179 |
attggaaaaatgtgtatgtcatgtttattaaaattctaatcatgttcctatgtt |
232 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5216073 |
ataggaaaaatgtgtatgtcatgtttattaaaattctaatcatgttcctatgtt |
5216126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 58 - 145
Target Start/End: Original strand, 5162195 - 5162283
Alignment:
| Q |
58 |
tcaatgagctaactgtatatatgagtcatagaagatcaaaaatatgctgacttagcaatattgaagactgca-tatgaactgaatatca |
145 |
Q |
| |
|
||||| ||||||||||||| || ||||||||| ||||||| ||||| |||| || ||||||||||||| || |||||||| ||||||| |
|
|
| T |
5162195 |
tcaattagctaactgtatacatttgtcatagaatatcaaaattatgcagactcagaaatattgaagacttcattatgaacttaatatca |
5162283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 224
Target Start/End: Original strand, 5203866 - 5203908
Alignment:
| Q |
182 |
ggaaaaatgtgtatgtcatgtttattaaaattctaatcatgtt |
224 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||| |||| |
|
|
| T |
5203866 |
ggaaaaatgtgtatgtaatgtttattaaaattctgatcgtgtt |
5203908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University