View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5368_low_36 (Length: 236)
Name: NF5368_low_36
Description: NF5368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5368_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 3 - 222
Target Start/End: Original strand, 8918694 - 8918912
Alignment:
| Q |
3 |
gcacgtgtacatatatatagtgtgtgcatgctcttgatgcatcatatcctcatgcaattgagttcaaatatagtnnnnnnnntattaagagatttttatt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8918694 |
gcacgtgtacatatatatagtgtgtgcatgctcttgatgcatcatatcctcatgcaattgagttcaaatatagtaaaaaaa-tattaagagatttttatt |
8918792 |
T |
|
| Q |
103 |
ctgtgtttcttaagaattcatctcctcatgtaactattgtttttatttttggcaaaagtgattaccggttagtactacatgaatgttcgattcctttata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8918793 |
ctgtgtttcttaagaattcatctcctcatgtaactattgtttttatttttggcaaaagtgattaccggttagtactacatgaatgttcgattcctttata |
8918892 |
T |
|
| Q |
203 |
tggttactactaagagaatg |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
8918893 |
tggttactactaagagaatg |
8918912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University