View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5369_high_2 (Length: 415)
Name: NF5369_high_2
Description: NF5369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5369_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 4e-88; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 31 - 203
Target Start/End: Complemental strand, 33513727 - 33513555
Alignment:
| Q |
31 |
agttggtcgatgaggtgacggaattcggggaggttgtagtggaaacggaaggagtcggaggtggggatggattggagggaggcagagagggcagagaggt |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
33513727 |
agttggtcgatgaggtgacggaattcggggaggttgtagtggaaacggaaggagtcggaggtggggatggattggagggaggcggagagggcggagaggt |
33513628 |
T |
|
| Q |
131 |
ggtggttgaaatcttccattgaaaggggtttagggttagggtttttggggatttggtgaaggggatgaaatgg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33513627 |
ggtggttgaaatcttccattgaaaggggtttagggttagggtttttggggatttggtgaaggggatgaaatgg |
33513555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 274 - 386
Target Start/End: Complemental strand, 44009118 - 44009006
Alignment:
| Q |
274 |
ggggtaattttggatgtaacccttcagttccagcagtgttcataggtggaaaatttgttggatcttcaaaagatgtgatatctcatcatgttgatggatc |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44009118 |
ggggtaattttggatgtaacccttcagttccagcagtgttcataggtggaaaatttgttggatcttcaaaagatgtgatatctcatcatgttgatggatc |
44009019 |
T |
|
| Q |
374 |
tctcaaacaaatg |
386 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44009018 |
tctcaaacaaatg |
44009006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 274 - 386
Target Start/End: Complemental strand, 44005192 - 44005080
Alignment:
| Q |
274 |
ggggtaattttggatgtaacccttcagttccagcagtgttcataggtggaaaatttgttggatcttcaaaagatgtgatatctcatcatgttgatggatc |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44005192 |
ggggtaattttggatgtaacccttcagttccagcagtgttcataggtggaaaatttgtaggatcctcaaaagatgtgatatctcatcatgttgatggatc |
44005093 |
T |
|
| Q |
374 |
tctcaaacaaatg |
386 |
Q |
| |
|
|||||||||||| |
|
|
| T |
44005092 |
actcaaacaaatg |
44005080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 39 - 203
Target Start/End: Complemental strand, 34121195 - 34121033
Alignment:
| Q |
39 |
gatgaggtgacggaattcggggaggttgtagtggaaacggaaggagtcggaggtggggatggattggagggaggcagagagggcagagaggtggtggttg |
138 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
34121195 |
gatgagatgacggaattcggggaggtagtagtggaaacggaatgagtcggaggtggggatggattggagggagg--tagagggcggagaggtggtggttg |
34121098 |
T |
|
| Q |
139 |
aaatcttccattgaaaggggtttagggttagggtttttggggatttggtgaaggggatgaaatgg |
203 |
Q |
| |
|
|| |||||||||| | ||| || |||||||||||||||||| |||||| ||| ||| |||||||| |
|
|
| T |
34121097 |
aagtcttccattggaggggtttaagggttagggtttttgggaatttggcgaacggggtgaaatgg |
34121033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 283 - 386
Target Start/End: Original strand, 39846804 - 39846907
Alignment:
| Q |
283 |
ttggatgtaacccttcagttccagcagtgttcataggtggaaaatttgttggatcttcaaaagatgtgatatctcatcatgttgatggatctctcaaaca |
382 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||| || || ||||| ||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
39846804 |
ttggatgtaacccttcagtgccagcagtgttcattggtggaaaatttgtagggtcatcaaaggatgtgatatctcttcatgttgatggatcactcaaaca |
39846903 |
T |
|
| Q |
383 |
aatg |
386 |
Q |
| |
|
|||| |
|
|
| T |
39846904 |
aatg |
39846907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University