View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5370_high_2 (Length: 226)

Name: NF5370_high_2
Description: NF5370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5370_high_2
NF5370_high_2
[»] chr1 (1 HSPs)
chr1 (95-209)||(51386692-51386806)


Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 95 - 209
Target Start/End: Original strand, 51386692 - 51386806
Alignment:
95 catgatccacacaacaacgattgagatggagaataaattttgtaccttgtgagcttttaaattaggagatggagaagaaagggtaaaccaaaggagaaga 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51386692 catgatccacacaacaacgattgagatggagaataaattttgtaccttgtgagcttttaaattaggagatggagaagaaagggtaaaccaaaggagaaga 51386791  T
195 aagaatgtaaatatt 209  Q
    |||||||||||||||    
51386792 aagaatgtaaatatt 51386806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University