View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5370_low_2 (Length: 226)
Name: NF5370_low_2
Description: NF5370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5370_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 95 - 209
Target Start/End: Original strand, 51386692 - 51386806
Alignment:
| Q |
95 |
catgatccacacaacaacgattgagatggagaataaattttgtaccttgtgagcttttaaattaggagatggagaagaaagggtaaaccaaaggagaaga |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51386692 |
catgatccacacaacaacgattgagatggagaataaattttgtaccttgtgagcttttaaattaggagatggagaagaaagggtaaaccaaaggagaaga |
51386791 |
T |
 |
| Q |
195 |
aagaatgtaaatatt |
209 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
51386792 |
aagaatgtaaatatt |
51386806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University