View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5372-Insertion-1 (Length: 81)
Name: NF5372-Insertion-1
Description: NF5372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5372-Insertion-1 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 1e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 1e-34
Query Start/End: Original strand, 8 - 81
Target Start/End: Complemental strand, 8448741 - 8448668
Alignment:
| Q |
8 |
caacaatacttcaatcttccacactctgcgggagggtaaccaatgcgctgattttttggttaagattggagctt |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8448741 |
caacaatacttcaatcttccacactctgcgggagggtaaccaatgcgctgattttttggttaagattggagctt |
8448668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 8 - 64
Target Start/End: Complemental strand, 4348840 - 4348784
Alignment:
| Q |
8 |
caacaatacttcaatcttccacactctgcgggagggtaaccaatgcgctgatttttt |
64 |
Q |
| |
|
|||||| |||| |||||| |||||| ||||||||||||| ||||||| ||||||||| |
|
|
| T |
4348840 |
caacaacactttaatctttcacactttgcgggagggtaatcaatgcgttgatttttt |
4348784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 70
Target Start/End: Complemental strand, 40557184 - 40557122
Alignment:
| Q |
8 |
caacaatacttcaatcttccacactctgcgggaggg-taaccaatgcgctgattttttggttaa |
70 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||| ||||||||||| |||||||||| |||| |
|
|
| T |
40557184 |
caacaatacttcaatctttcacaca-tgcgggaggggtaaccaatgcgttgattttttgtttaa |
40557122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University