View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5373-Insertion-10 (Length: 137)
Name: NF5373-Insertion-10
Description: NF5373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5373-Insertion-10 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 5e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 5e-63
Query Start/End: Original strand, 8 - 137
Target Start/End: Original strand, 6982977 - 6983106
Alignment:
| Q |
8 |
agaggtatgtgtaccctttgcttgtcatggcaggttcctctttgtttcgttgctaaaggatagctttaggcttcaattctttatgttgtgtaaacatgtt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6982977 |
agaggtatgtgtaccctttgcttgtcatggcaggttcctctttgtttcgttgctaaaggatagctttaggcttcaattctttatgttgtgtaaacatgtt |
6983076 |
T |
|
| Q |
108 |
taggtcttaatcttgattcgcaattaattt |
137 |
Q |
| |
|
||||||||||||||| || ||||||||||| |
|
|
| T |
6983077 |
taggtcttaatcttggtttgcaattaattt |
6983106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 21 - 103
Target Start/End: Complemental strand, 51499780 - 51499698
Alignment:
| Q |
21 |
ccctttgcttgtcatggcaggttcctctttgtttc-gttgctaaaggatagctttaggcttcaattctttatgttgtgtaaaca |
103 |
Q |
| |
|
|||||||||| | |||||||| |||||||||||| |||| ||||||||||| ||||||||| |||||| | ||||||||||| |
|
|
| T |
51499780 |
ccctttgctttt-atggcaggctcctctttgtttttgttgataaaggatagccttaggcttcctttctttcttttgtgtaaaca |
51499698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University