View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5373_low_2 (Length: 228)
Name: NF5373_low_2
Description: NF5373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5373_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 7 - 173
Target Start/End: Complemental strand, 13856386 - 13856221
Alignment:
| Q |
7 |
ctaacacacactattatatattggttaaacttcacagagttctaccaactttatgtggtatctacgtattttagtaggatttatttgaatttcaacaaat |
106 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13856386 |
ctaacacactctattatatattggttaaacttcacagagttctaccaactttatgtggtatctacgtattttagtaggatttatttgactttcaacaaat |
13856287 |
T |
 |
| Q |
107 |
acaaatgagtgtgttaggtagcataaattaaaatgaaagagttgaaatttatcacgttcatgatggt |
173 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13856286 |
acaaatgagtgtgttaagta-aataaattaaaatgaaagagttgaaatttatcacgttcatgatggt |
13856221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 23 - 107
Target Start/End: Complemental strand, 13865540 - 13865455
Alignment:
| Q |
23 |
tatattggttaaacttcaca-gagttctaccaactttatgtggtatctacgtattttagtaggatttatttgaatttcaacaaata |
107 |
Q |
| |
|
||||||||||||| ||||| ||||| || ||| ||||||||| |||||| ||||||||||||||| |||||||||| |||||||| |
|
|
| T |
13865540 |
tatattggttaaaattcacttgagttatagcaaatttatgtggaatctacatattttagtaggattaatttgaattttaacaaata |
13865455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University