View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5373_low_5 (Length: 203)
Name: NF5373_low_5
Description: NF5373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5373_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 185
Target Start/End: Complemental strand, 5509733 - 5509565
Alignment:
| Q |
17 |
caaagggggttgagcaatttctggaattgggcttggttttatagggattgtggtaactgaaagttttctagtagtgatttttctctcttttgggacaatg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5509733 |
caaagggggttgagcaatttctggaattggggttggttttatagggattgtggtaactgaaagttttctaatagtgatttttctctcttttgggacaatg |
5509634 |
T |
 |
| Q |
117 |
gtagcaatgtttatgatattgttatggttgaaaaatccaagctttttcatggattctaaatgggaagac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5509633 |
gtagcaatgtttatgatattgttatggttgaaaaatccaagctttttcatggattctaaatgggaagac |
5509565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 63 - 185
Target Start/End: Complemental strand, 20432989 - 20432869
Alignment:
| Q |
63 |
attgtggtaactgaaagttttctagtagtgatttttctctcttttgggacaatggtagcaatgtttatgatattgttatggttgaaaaatccaagctttt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
20432989 |
attgtggtaactgaaagttttctagtagtgatttttatctcttttggtacaatggtagcaatgtttatgatattg--gtggctgaaaaatccaagctttt |
20432892 |
T |
 |
| Q |
163 |
tcatggattctaaatgggaagac |
185 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
20432891 |
tcatggattctaaatgggaagac |
20432869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University