View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5374-Insertion-1 (Length: 127)
Name: NF5374-Insertion-1
Description: NF5374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5374-Insertion-1 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 2e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 7 - 127
Target Start/End: Original strand, 37662081 - 37662201
Alignment:
| Q |
7 |
aaaaacaaggttttgttcttatggctgatcttcttcatcgttcaccaccattctttcttccacctaaaaactcaactttctttgccatcaaagattctgc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37662081 |
aaaaacaaggttttgttcttatggctgatcttcttcatcgttcaccaccattctttcttccacctaaaaactcaactttctttgccatcaaagattctgc |
37662180 |
T |
|
| Q |
107 |
tatcaaaaacacctcactccc |
127 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37662181 |
tatcaaaaacacctcactccc |
37662201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University