View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5374-Insertion-8 (Length: 223)
Name: NF5374-Insertion-8
Description: NF5374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5374-Insertion-8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 8 - 223
Target Start/End: Original strand, 35178644 - 35178859
Alignment:
| Q |
8 |
tacggcaggtgctttggcatgatactcacaaaccttatgtctccggtgatattgcttagcttcactaagatcagcatcacaattctccacttgacaacaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35178644 |
tacggcaggtgctttggcatgatactcacaaaccttatgtctccggtgatattgcttagcttcactaagatcagcatcacaattctccacttgacaacaa |
35178743 |
T |
 |
| Q |
108 |
ggtggaatgtttgagcttccagcttttttggaacttctcttgctatagagatctgtcactaccctcttccttctaccatcctcttcctcttcaaagtctg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
35178744 |
ggtggaatgtttgagcttccagcttttttggaacttctcttgctatagagatctgtcactaccctcttccttctaccatcctcttcctcttcaaaatccg |
35178843 |
T |
 |
| Q |
208 |
tatcctcttcctcttc |
223 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
35178844 |
tatcctcttcctcttc |
35178859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University