View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5374_low_8 (Length: 246)
Name: NF5374_low_8
Description: NF5374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5374_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 9 - 170
Target Start/End: Original strand, 27166296 - 27166457
Alignment:
| Q |
9 |
gaagaatatgatatttgagaaagtaaattgaaaattcattcaaaatataaacttttgcttttaatttcttaaatatgagtttacaattcgataagaacta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
27166296 |
gaagaatatgatatttgagaaagtaaattgaaaattcattcaaaatataaacttttccttttaatttcttaaatatgagtttacaaattgataagaacta |
27166395 |
T |
|
| Q |
109 |
attcaacataaaccaaatactttggggactaaaaataatatccaacattttattagttgtaa |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
27166396 |
attcaacataaaccaaatactttggggactaaaactaatatcaaacattttattagttgtaa |
27166457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 179 - 227
Target Start/End: Original strand, 27166491 - 27166539
Alignment:
| Q |
179 |
ctaatgtcatattcactttgctcattgcaggataaactagcagggcttg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27166491 |
ctaatgtcatattcactttgctcattgcaggataaactagcagggcttg |
27166539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 179 - 227
Target Start/End: Original strand, 27221139 - 27221187
Alignment:
| Q |
179 |
ctaatgtcatattcactttgctcattgcaggataaactagcagggcttg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27221139 |
ctaatgtcatattcactttgctcattgcaggataaactagcagggcttg |
27221187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University