View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5374_low_9 (Length: 222)
Name: NF5374_low_9
Description: NF5374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5374_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 23 - 220
Target Start/End: Original strand, 104787 - 104983
Alignment:
| Q |
23 |
gttgatgatgcttctatttttgcataacactaacatgaatgagcatacatataatgtaacaagaagaccacagcttactttttctatagtccannnnnnn |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
104787 |
gttgatgatgcttctatttttgcataacactaacatgaatgagcatacatataatgtaacaagaa-accacagcttactttttctatagtccaattatat |
104885 |
T |
 |
| Q |
123 |
nnnnnnnnnnnnnnnnnctacattatgcatttggaatggaatcacaattttggattttatagagccagtaaattacctttcttccacctttgcttctc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
104886 |
tatattatattatattactacattatgcatttggaatggaatcacaattttggattttatagagccagtaaattacctttcttccacctttgtttctc |
104983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University