View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5375_high_5 (Length: 238)
Name: NF5375_high_5
Description: NF5375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5375_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 39531223 - 39531429
Alignment:
| Q |
19 |
ggagctctaattttggcttcttcatcatagttgttgatggtgaggctcttttggctaaggattgggaaaagtgaagcatttgctatgaatatgttggata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39531223 |
ggagctctaattttggcttcttcatcatagttgttgatggtgaggctcttttggctaaggattgggaaaagtgaagcatttgctatgaatatgttggata |
39531322 |
T |
 |
| Q |
119 |
aaagaaaccatagaagaagaggtcttaggattttaggagtcataatgaattgaaacaaatacttaatttgtgatgatttttgcaatatggattgtggtgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39531323 |
aaagaaaccatagaagaagaggtcttaggattttaggagtcataatgaattgaaacaaatacttaatttgtgatgatttttgcaatatggattgtggtgt |
39531422 |
T |
 |
| Q |
219 |
gtgatga |
225 |
Q |
| |
|
||||||| |
|
|
| T |
39531423 |
gtgatga |
39531429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University