View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5375_low_5 (Length: 238)

Name: NF5375_low_5
Description: NF5375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5375_low_5
NF5375_low_5
[»] chr2 (1 HSPs)
chr2 (19-225)||(39531223-39531429)


Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 39531223 - 39531429
Alignment:
19 ggagctctaattttggcttcttcatcatagttgttgatggtgaggctcttttggctaaggattgggaaaagtgaagcatttgctatgaatatgttggata 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39531223 ggagctctaattttggcttcttcatcatagttgttgatggtgaggctcttttggctaaggattgggaaaagtgaagcatttgctatgaatatgttggata 39531322  T
119 aaagaaaccatagaagaagaggtcttaggattttaggagtcataatgaattgaaacaaatacttaatttgtgatgatttttgcaatatggattgtggtgt 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39531323 aaagaaaccatagaagaagaggtcttaggattttaggagtcataatgaattgaaacaaatacttaatttgtgatgatttttgcaatatggattgtggtgt 39531422  T
219 gtgatga 225  Q
    |||||||    
39531423 gtgatga 39531429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University