View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5377_high_4 (Length: 324)
Name: NF5377_high_4
Description: NF5377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5377_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 6 - 306
Target Start/End: Original strand, 41299483 - 41299783
Alignment:
| Q |
6 |
aagagcaacaaagaaacacgacaacctcggacggaggaaacaatattaatcatgaagaggataatcttaatgtacttcaaaaccaatctcaaactcaacc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41299483 |
aagagcaacaaagaaacacgacaacctcggacggaggaaacaatattaatcatgaagaggataatcttaatgtacttcaaaaccaatctcaaactcaacc |
41299582 |
T |
 |
| Q |
106 |
tcacgaggatcaaaagccacgactccttcgaatcgattctgaatgtgtctcgtctatcatcaacaatgatcataaaaatgatgctaataataagaatttg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41299583 |
tcacgaggatcaaaagccacgactccttcgaatcgattctgaatgtgtctcgtctatcatcaacaatgatcataaaaatgatgctaataataagaatttg |
41299682 |
T |
 |
| Q |
206 |
aatcatcatcaattagccgcggatacgtttggatcggttgatattgatttttcatcttataatacgcatcattcttcttctgacatggttgctgcttaca |
305 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41299683 |
aatcatcatcaattagccgcggatgcgtttggctcggttgatattgatttttcatcttataatacgcatcattcttcttctgacatggttgctgcttaca |
41299782 |
T |
 |
| Q |
306 |
c |
306 |
Q |
| |
|
| |
|
|
| T |
41299783 |
c |
41299783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University