View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5377_high_6 (Length: 273)
Name: NF5377_high_6
Description: NF5377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5377_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 14 - 158
Target Start/End: Original strand, 45108575 - 45108716
Alignment:
| Q |
14 |
gacatggacgtttcattcatagatttaaataatgtatcatctgtgcttcctatccccatgatgactcaaacccaaaatcaccacgatgagaaaaattatg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45108575 |
gacatggacgtttcattcatagatttaaataatgtatcatctgtgctacctatccccatga---ctcaaacccaaaatcaccacgatgagaaaaattatg |
45108671 |
T |
 |
| Q |
114 |
atagttacgttgttaaagagaaagatgcatgaattaaataattaa |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45108672 |
atagttacgttgttaaagagaaagatgcatgaattaaataattaa |
45108716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 180 - 256
Target Start/End: Original strand, 45108751 - 45108827
Alignment:
| Q |
180 |
attaaagatgtttaacatttaacaacctaacttagcttatagcttagttgtgagtgtggtgaagtttgttgtcataa |
256 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45108751 |
attaaagatgtttaacatttaacaacctagcttagcttatagcttagttgtgagtgtggtgaagtttgttgtcataa |
45108827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University